What is primary and secondary structure of DNA?

Related questions

1. What is physical structure of DNA?
2. What are examples of DNA?
3. What are the significance of the structure of DNA?
4. What's the difference between genes and DNA?
5. How does DNA code for traits?
6. What is DNA and its structure and function?
7. How do nucleotides affect the structure of DNA?
8. What are the 4 components of DNA?
9. What is your DNA?
10. Why was discovering the structure of DNA so important?

Tags

1. #primary
2. #bases
3. #often
4. #attttcgtaaaggcgtaaaggcctttgtc
5. #forms
6. #hairpin
7. #things
8. #strand
9. #helix
10. #structures
11. #while
12. #tends
13. #double
14. #between
15. #secondary
16. #complex
17. #structure
18. #bondind
19. #interactions
20. #sequence
21. #loops
22. #intramolecular